Puro-iNotch1IC
(Plasmid #75338)

• Purpose: doxycycline inducible Notch1 intracellular domain gene over-expression
• Depositing Lab: Danwei Huangfu
• Publication: Zhu et al Cell Stem Cell. 2016 Apr 27. pii: S1934-5909(16)30002-9. doi: 10.1016/j.stem.2016.03.015.

Backbone

• Vector backbone: N/A
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Notch1 Intracellular domain
• Alt name: Notch1IC
• Species: M. musculus (mouse)
• Entrez Gene: Notch1 (a.k.a. 9930111A19Rik, Mis6, N1, Tan1, lin-12)
• Promoter: TRE-tight

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: cagctcaggttctgggagag
• 3′ sequencing primer: gaaatttgtgatgctattgc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene: 15079
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry