Puro-iNgn3
(Plasmid
#75337)
-
Purposedoxycycline inducible Ngn3 over-expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75337 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneN/A
- Total vector size (bp) 7954
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameneurogenin 3
-
Alt nameNgn3
-
Alt nameNeurog3
-
SpeciesM. musculus (mouse)
-
GenBank ID50674
-
Entrez GeneNeurog3 (a.k.a. Atoh5, Math4B, bHLHa7, ngn3)
- Promoter TRE-tight
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cagctcaggttctgggagag
- 3′ sequencing primer gaaatttgtgatgctattgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Puro-iNgn3 was a gift from Danwei Huangfu (Addgene plasmid # 75337 ; http://n2t.net/addgene:75337 ; RRID:Addgene_75337) -
For your References section:
Genome Editing of Lineage Determinants in Human Pluripotent Stem Cells Reveals Mechanisms of Pancreatic Development and Diabetes. Zhu Z, Li QV, Lee K, Rosen BP, Gonzalez F, Soh CL, Huangfu D. Cell Stem Cell. 2016 Apr 27. pii: S1934-5909(16)30002-9. doi: 10.1016/j.stem.2016.03.015. 10.1016/j.stem.2016.03.015 PubMed 27133796