pMAL-c4E
(Plasmid
#75293)
-
Purpose(Empty Backbone) Expresses proteins in the cytoplasm as fusions to a high-binding mutant (A313V) maltose-binding protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMAL-c4E
-
Backbone manufacturerNew England Biolabs
- Backbone size (bp) 6648
-
Modifications to backbonemalE A313V
-
Vector typeBacterial Expression
- Promoter tac
-
Tag
/ Fusion Protein
- maltose-binding protein (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAny E. coli strain can be used for expression of fusion proteins; NEBExpress, BL21, or BL21(DE3) are good first choices
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Commercial use requires a license from New England Biolabs
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAL-c4E was a gift from Paul Riggs (Addgene plasmid # 75293 ; http://n2t.net/addgene:75293 ; RRID:Addgene_75293) -
For your References section:
Mutations in maltose-binding protein that alter affinity and solubility properties. Walker IH, Hsieh PC, Riggs PD. Appl Microbiol Biotechnol. 2010 Sep;88(1):187-97. doi: 10.1007/s00253-010-2696-y. Epub 2010 Jun 10. 10.1007/s00253-010-2696-y PubMed 20535468