Skip to main content
Addgene

pMAL-p4X
(Plasmid #75289)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75289 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pMAL-p4X
  • Backbone manufacturer
    New England Biolabs
  • Backbone size (bp) 6720
  • Modifications to backbone
    malE A313V
  • Vector type
    Bacterial Expression
  • Promoter tac
  • Tag / Fusion Protein
    • maltose-binding protein (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Any E. coli strain can be used for expression of fusion proteins; NEBExpress, BL21, or BL21(DE3) are good first choices
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Commercial use requires a license from New England Biolabs

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-p4X was a gift from Paul Riggs (Addgene plasmid # 75289 ; http://n2t.net/addgene:75289 ; RRID:Addgene_75289)

  • For your References section:

    Mutations in maltose-binding protein that alter affinity and solubility properties. Walker IH, Hsieh PC, Riggs PD. Appl Microbiol Biotechnol. 2010 Sep;88(1):187-97. doi: 10.1007/s00253-010-2696-y. Epub 2010 Jun 10. 10.1007/s00253-010-2696-y PubMed 20535468
Related items:
Commonly requested with: