Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

H2B-pDendra2(N)
(Plasmid #75283)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75283 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDendra2-N
  • Backbone manufacturer
    Evrogen
  • Backbone size w/o insert (bp) 4705
  • Total vector size (bp) 5105
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2bk
  • Alt name
    HIST1H2BK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    378
  • GenBank ID
    NM_080593.2
  • Entrez Gene
    H2BC12 (a.k.a. H2B/S, H2BFAiii, H2BFT, H2BK, HIST1H2BK)
  • Promoter CMV
  • Tag / Fusion Protein
    • Dendra2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Xavier Darzacq
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    H2B-pDendra2(N) was a gift from Xavier Darzacq (Addgene plasmid # 75283 ; http://n2t.net/addgene:75283 ; RRID:Addgene_75283)
  • For your References section:

    Single cell correlation fractal dimension of chromatin: a framework to interpret 3D single molecule super-resolution. Recamier V, Izeddin I, Bosanac L, Dahan M, Proux F, Darzacq X. Nucleus. 2014 Jan-Feb;5(1):75-84. doi: 10.4161/nucl.28227. Epub 2014 Feb 19. 10.4161/nucl.28227 PubMed 24637833