Skip to main content
Addgene

Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
(Plasmid #75240)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75240 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX458-pSpCas9(BB)2A-GFP
  • Backbone manufacturer
    Feng Zhang (Plasmid #48138)
  • Backbone size w/o insert (bp) 9703
  • Total vector size (bp) 9703
  • Modifications to backbone
    CBH promoter exchanged for hEF1a promoter
  • Vector type
    CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA against human Ikaros
  • Alt name
    IKZF1
  • gRNA/shRNA sequence
    (gg)TCTGGAGTATCGCTTACAGG
  • Species
    H. sapiens (human)
  • GenBank ID
    10320 (Gene-ID)
  • Entrez Gene
    IKZF1 (a.k.a. CVID13, Hs.54452, IK1, IKAROS, LYF1, LyF-1, PPP1R92, PRO0758, ZNFN1A1)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA contains at least 3 missmatches against human DNA (http://crispr.mit.edu) 2 additional nonmatching Guanidines added at 5' to enhance specificity (Kim, D. et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat. Methods 12, 237–43, 1 p following 243 (2015).)
targets all isoforms.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP) was a gift from Ria Baumgrass (Addgene plasmid # 75240 ; http://n2t.net/addgene:75240 ; RRID:Addgene_75240)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333