Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
(Plasmid #75238)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75238 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX461-pSpCas9n(BB)2A-GFP
  • Backbone manufacturer
    Feng Zhang (Plasmid #48140)
  • Backbone size w/o insert (bp) 9703
  • Total vector size (bp) 9703
  • Modifications to backbone
    CBH promoter exchanged for hEF1a promoter
  • Vector type
    CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA against NFATc1
  • Alt name
    NFAT2
  • gRNA/shRNA sequence
    (gg)CCCGCCGGCGGATCACCCCT
  • Species
    H. sapiens (human)
  • GenBank ID
    ID: 4772 (GENE-ID)
  • Entrez Gene
    NFATC1 (a.k.a. NF-ATC, NF-ATc1.2, NFAT2, NFATc)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA contains at least 3 missmatches against human DNA (http://crispr.mit.edu) 2 additional nonmatching Guanidines added at 5' to enhnace specificy (Kim, D. et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat. Methods 12, 237–43, 1 p following 243 (2015).)
targets all isoforms.
MUST BE COTRANSFECTED WITH PLASMID #75239

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP) was a gift from Ria Baumgrass (Addgene plasmid # 75238 ; http://n2t.net/addgene:75238 ; RRID:Addgene_75238)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333