pP2AeGFP-Mars1Cy
(Plasmid #75223)

• Purpose: Mammalian intracellular expression of fluorogen activating protein Mars1Cy and eGFP
• Depositing Lab: Alan Waggoner
• Publication: Zhang et al J Clin Invest. 2015 Oct 1;125(10):3915-27. doi: 10.1172/JCI81086. Epub 2015 Sep 8.

Backbone

• Vector backbone: pEGFP
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3958
• Total vector size (bp): 5476
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP-p2a-Mars1Cy
• Alt name: EGFP-p2a-dL9.5
• Species: Synthetic
• Insert Size (bp): 1518
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: ctctacaaatgtggtatggctg

Resource Information

• Supplemental Documents:
  • annotated map pP2AeGFPMars1Cy

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry