Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMars1CyeGFP
(Plasmid #75222)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75222 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3958
  • Total vector size (bp) 5452
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mars1Cy-EGFP
  • Alt name
    dL9.5-EGFP
  • Species
    Synthetic
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer ctctacaaatgtggtatggctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMars1CyeGFP was a gift from Alan Waggoner (Addgene plasmid # 75222 ; http://n2t.net/addgene:75222 ; RRID:Addgene_75222)
  • For your References section:

    Fluoromodule-based reporter/probes designed for in vivo fluorescence imaging. Zhang M, Chakraborty SK, Sampath P, Rojas JJ, Hou W, Saurabh S, Thorne SH, Bruchez MP, Waggoner AS. J Clin Invest. 2015 Oct 1;125(10):3915-27. doi: 10.1172/JCI81086. Epub 2015 Sep 8. 10.1172/JCI81086 PubMed 26348895