Skip to main content
Addgene

pLC-BFP-FADD
(Plasmid #75166)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75166 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPRv1
  • Total vector size (bp) 11696
  • Modifications to backbone
    Swap puromycin resistance for TagBFP
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FADD sgRNA
  • Alt name
    Fas-Associated Death Domain
  • gRNA/shRNA sequence
    ACTCCCGCACACGCTCTGTC
  • Species
    H. sapiens (human)
  • GenBank ID
    NC_000011.10
  • Entrez Gene
    FADD (a.k.a. GIG3, IMD90, MORT1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 3′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer AAACGACAGAGCGTGTGCGGGAGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLC-BFP-FADD was a gift from Beat Bornhauser (Addgene plasmid # 75166 ; http://n2t.net/addgene:75166 ; RRID:Addgene_75166)
  • For your References section:

    Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. McComb S, Aguade-Gorgorio J, Harder L, Marovca B, Cario G, Eckert C, Schrappe M, Stanulla M, von Stackelberg A, Bourquin JP, Bornhauser BC. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. 10.1126/scitranslmed.aad2986 PubMed 27194728