Skip to main content
Addgene

pLC-EGFP-RIP3
(Plasmid #75165)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75165 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPRv1
  • Total vector size (bp) 11696
  • Modifications to backbone
    Swap puromycin resistance for EGFP
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RIP3 sgRNA
  • Alt name
    Receptor-interacting protein kinase 3
  • Alt name
    RIPk3
  • gRNA/shRNA sequence
    TACACGAGTGATGGTTCGGT
  • Species
    H. sapiens (human)
  • GenBank ID
    NC_000014.9
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 3′ cloning site BsmBI (Esp3I) (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer AAACACCGAACCATCACTCGTGTAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLC-EGFP-RIP3 was a gift from Beat Bornhauser (Addgene plasmid # 75165 ; http://n2t.net/addgene:75165 ; RRID:Addgene_75165)

  • For your References section:

    Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. McComb S, Aguade-Gorgorio J, Harder L, Marovca B, Cario G, Eckert C, Schrappe M, Stanulla M, von Stackelberg A, Bourquin JP, Bornhauser BC. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. 10.1126/scitranslmed.aad2986 PubMed 27194728
Related items:
Commonly requested with: