MSCV-miRE_shBRD9_561-SV40-GFP
(Plasmid
#75139)
-
PurposeRetroviral expression plasmid encoding shBRD9_561 (targeting human BRD)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV-miRE- shRNA-SV40-GFP
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshBRD9_561
-
gRNA/shRNA sequenceTTCATTAGCTACAATTTTGTCT
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer TGTTTGAATGAGGCTTCAGTAC
- 3′ sequencing primer - (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-miRE_shBRD9_561-SV40-GFP was a gift from Christopher Vakoc (Addgene plasmid # 75139 ; http://n2t.net/addgene:75139 ; RRID:Addgene_75139) -
For your References section:
Sensitivity and engineered resistance of myeloid leukemia cells to BRD9 inhibition. Hohmann AF, Martin LJ, Minder JL, Roe JS, Shi J, Steurer S, Bader G, McConnell D, Pearson M, Gerstberger T, Gottschamel T, Thompson D, Suzuki Y, Koegl M, Vakoc CR. Nat Chem Biol. 2016 Jul 4. doi: 10.1038/nchembio.2115. 10.1038/nchembio.2115 PubMed 27376689