Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MSCV-miRE_shBRD9_508-SV40-GFP
(Plasmid #75138)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75138 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MSCV-miRE- shRNA-SV40-GFP
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shBRD9_508
  • gRNA/shRNA sequence
    TTATCATTGAATATCCAGGAGC
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer TGTTTGAATGAGGCTTCAGTAC
  • 3′ sequencing primer -
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-miRE_shBRD9_508-SV40-GFP was a gift from Christopher Vakoc (Addgene plasmid # 75138 ; http://n2t.net/addgene:75138 ; RRID:Addgene_75138)
  • For your References section:

    Sensitivity and engineered resistance of myeloid leukemia cells to BRD9 inhibition. Hohmann AF, Martin LJ, Minder JL, Roe JS, Shi J, Steurer S, Bader G, McConnell D, Pearson M, Gerstberger T, Gottschamel T, Thompson D, Suzuki Y, Koegl M, Vakoc CR. Nat Chem Biol. 2016 Jul 4. doi: 10.1038/nchembio.2115. 10.1038/nchembio.2115 PubMed 27376689