MSCV-TRE-dsRed-miR30_shBrd9_1061-PGK-Venus-IRES-NeoR
(Plasmid
#75135)
-
PurposeRetroviral expression plasmid encoding inducible shBrd9_1061 (targeting murine Brd9)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV-TRE-dsRed-miR30-shRNA-PGK-Venus-IRES-NeoR
- Backbone size w/o insert (bp) 9127
-
Vector typeRetroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshBrd9_1061
-
gRNA/shRNA sequenceTTAGACAGTGAACTCAGGTCCA
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer TGT TTG AAT GAG GCT TCA GTA C
- 3′ sequencing primer - (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-TRE-dsRed-miR30_shBrd9_1061-PGK-Venus-IRES-NeoR was a gift from Christopher Vakoc (Addgene plasmid # 75135 ; http://n2t.net/addgene:75135 ; RRID:Addgene_75135) -
For your References section:
Sensitivity and engineered resistance of myeloid leukemia cells to BRD9 inhibition. Hohmann AF, Martin LJ, Minder JL, Roe JS, Shi J, Steurer S, Bader G, McConnell D, Pearson M, Gerstberger T, Gottschamel T, Thompson D, Suzuki Y, Koegl M, Vakoc CR. Nat Chem Biol. 2016 Jul 4. doi: 10.1038/nchembio.2115. 10.1038/nchembio.2115 PubMed 27376689