pMSCV-Zeo-NKX2-8
(Plasmid
#75090)
-
Purposeretrovirus-mediated gene transfer into mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV-Zeocin
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNKX2-8
-
SpeciesH. sapiens (human)
-
Mutationwild-type, full-length, without native 3' UTR
-
Entrez GeneNKX2-8 (a.k.a. NKX2.8, NKX2H, Nkx2-9)
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-Zeo-NKX2-8 was a gift from David Mu (Addgene plasmid # 75090 ; http://n2t.net/addgene:75090 ; RRID:Addgene_75090) -
For your References section:
Oncogenic cooperation and coamplification of developmental transcription factor genes in lung cancer. Kendall J, Liu Q, Bakleh A, Krasnitz A, Nguyen KC, Lakshmi B, Gerald WL, Powers S, Mu D. Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16663-8. Epub 2007 Oct 9. 10.1073/pnas.0708286104 PubMed 17925434