pMSCV-Zeo-TTF-1
(Plasmid #75089)

• Purpose: retrovirus-mediated gene transfer into mammalian cells
• Depositing Lab: David Mu
• Publication: Kendall et al Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16663-8. Epub 2007 Oct 9.

Backbone

• Vector backbone: pMSCV-Zeocin
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TTF-1
• Species: H. sapiens (human)
• Mutation: wild-type, full-length, without native 3' UTR
• Entrez Gene: NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GAGACGTGCTACTTCCATTTGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry