pETDuet-msGC-NT13
(Plasmid #75087)

• Purpose: expresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and beta
• Depositing Lab: William Montfort
• Publication: Fritz et al Biochemistry. 2013 Mar 5;52(9):1568-82. doi: 10.1021/bi301570m. Epub 2013 Feb 15.

Backbone

• Vector backbone: pETDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 7805
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: fragment of alfa subunit of sGC
• Alt name: alpha msGC
• Species: manduca sexta (tobacco hornworm)
• Insert Size (bp): 1251
• Mutation: fragment 49-450 of the alfa subunit
• GenBank ID: AF062750
• Tag / Fusion Protein:
  • His-tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATGCGTCCGGCGTAGA
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Gene/Insert 2

• Gene/Insert name: fragment of beta subunit of sGC
• Alt name: beta msGC
• Species: manduca sexta (tobacco hornworm)
• Insert Size (bp): 1143
• Mutation: fragment 1-380 of the beta subunit
• GenBank ID: AF062751

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: EcorI (not destroyed)
• 5′ sequencing primer: TTGTACACGGCCGCATAATC
• 3′ sequencing primer: GCTAGTTATTGCTCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry