Skip to main content
Addgene

pMSCV-hygro-TTF-1 Q210K-Y214M
(Plasmid #75084)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75084 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMSCV-hygro
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TTF-1
  • Species
    H. sapiens (human)
  • Mutation
    Q210K and Y214M mutations in homeodomain
  • Entrez Gene
    NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains a mutant of TTF-1. The two mutated amino acid residues are in the homeodomain of TTF-1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-hygro-TTF-1 Q210K-Y214M was a gift from David Mu (Addgene plasmid # 75084 ; http://n2t.net/addgene:75084 ; RRID:Addgene_75084)

  • For your References section:

    Occludin is a direct target of thyroid transcription factor-1 (TTF-1/NKX2-1). Runkle EA, Rice SJ, Qi J, Masser D, Antonetti DA, Winslow MM, Mu D. J Biol Chem. 2012 Aug 17;287(34):28790-801. doi: 10.1074/jbc.M112.367987. Epub 2012 Jul 2. 10.1074/jbc.M112.367987 PubMed 22761434
Related items: