pMSCV-hygro-PAX9
(Plasmid #75083)

• Purpose: [Edit] retroviral vector holding human PAX9 cDNA
• Depositing Lab: David Mu
• Publication: Kendall et al Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16663-8. Epub 2007 Oct 9.

Backbone

• Vector backbone: pMSCV-hygro
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PAX9
• Species: H. sapiens (human)
• Mutation: full length, wild type, without native 3' UTR
• Entrez Gene: PAX9 (a.k.a. STHAG3)
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GAGACGTGCTACTTCCATTTGTC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry