pMX-HA-UbvG08_MUT-IRES-GFP
(Plasmid #75031)

• Purpose: Retroviral vector with ubiquitin variant with reverted mutations L69P and V70L (i53-DM mutant)
• Depositing Lab: Daniel Durocher
• Publication: Canny et al Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27.

Backbone

• Vector backbone: pMX-IRES-GFP
• Backbone manufacturer: Cell Biolabs, Inc.
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 6184
• Vector type: Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ubiquitin
• Alt name: synthetic engineered ubiquitin variant UbvG08 (i53 DM - mutant)
• Alt name: pMX-HA-i53-DM-IRES-GFP
• Species: Synthetic
• Insert Size (bp): 284
• Mutation: UbvG08 with I44A, P69L, and L70V mutations and no terminal Glycines
• Tags / Fusion Proteins:
  • HA (N terminal on insert)
  • IRES-eGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: GACGGCATCGCAGCTTGGATACAC

Resource Information

• Supplemental Documents:
  • 75031.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

bioRxiv (10.1101/060954)