pJJR50
(Plasmid #75026)

• Purpose: U6 promoter driven flipped + extended sgRNA expression vector
• Depositing Lab: Mike Boxem
• Publication: Waaijers et al BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x.

Backbone

• Vector backbone: pBluescript
• Backbone manufacturer: Stratagene
• Total vector size (bp): 2958
• Modifications to backbone: Inserted promoter + sgRNA into EcoRV
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: guide RNA, flipped and extended version
• Alt name: sgRNA
• gRNA/shRNA sequence: GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTT
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 80
• Promoter: R07E5.16 (U6)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (destroyed during cloning)
• 3′ cloning site: EcoRV (destroyed during cloning)
• 5′ sequencing primer: tgtaaaacgacggccagt
• 3′ sequencing primer: catggtcatagctgtttcctg

Resource Information

• Supplemental Documents:
  • Annotated ApE file
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector is for cloning an sgRNA. Sequence is inserted as an annealed oligonucleotide linker into vector digested with BbsI.