Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJJR50
(Plasmid #75026)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75026 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript
  • Backbone manufacturer
    Stratagene
  • Total vector size (bp) 2958
  • Modifications to backbone
    Inserted promoter + sgRNA into EcoRV
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    guide RNA, flipped and extended version
  • Alt name
    sgRNA
  • gRNA/shRNA sequence
    GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTT
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    80
  • Promoter R07E5.16 (U6)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer tgtaaaacgacggccagt
  • 3′ sequencing primer catggtcatagctgtttcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector is for cloning an sgRNA. Sequence is inserted as an annealed oligonucleotide linker into vector digested with BbsI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJJR50 was a gift from Mike Boxem (Addgene plasmid # 75026 ; http://n2t.net/addgene:75026 ; RRID:Addgene_75026)
  • For your References section:

    A tissue-specific protein purification approach in Caenorhabditis elegans identifies novel interaction partners of DLG-1/Discs large. Waaijers S, Munoz J, Berends C, Ramalho JJ, Goerdayal SS, Low TY, Zoumaro-Djayoon AD, Hoffmann M, Koorman T, Tas RP, Harterink M, Seelk S, Kerver J, Hoogenraad CC, Bossinger O, Tursun B, van den Heuvel S, Heck AJ, Boxem M. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. 10.1186/s12915-016-0286-x PubMed 27506200