AcpP pet29a C-terminal His Tag
(Plasmid #75016)

• Purpose: Expresses the acyl carrier protein (ACP) from the E. coli fatty acid synthase
• Depositing Lab: Michael Burkart
• Publication: Worthington et al ACS Chem Biol. 2006 Dec 20;1(11):687-91.

Backbone

• Vector backbone: pet29a
• Backbone size w/o insert (bp): 5371
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For protein expression, grow in BL21s at 37 degrees until an OD of 0.8 is reached (approximately 3-4 hours), induce with 0.5 mM IPTG and grow at 16 degrees for 16 hours.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AcpP
• Alt name: Acyl carrier protein from E. coli fatty acid synthase
• Species: E. coli
• Insert Size (bp): 238
• GenBank ID: 944805 NC_000913.3
• Entrez Gene: acpP (a.k.a. b1094, ECK1080)
• Promoter: T7
• Tag / Fusion Protein:
  • His Tag (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TAATACGACTCACTATAGGG (T7 promoter, forward primer)
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG (T7 terminator, reverse primer)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry