Skip to main content
Addgene

ZIKV_Sensor_32B_LacZ
(Plasmid #75007)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75007 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCOLA Duet
  • Backbone manufacturer
    EMD Millipore
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ZIKV_sensor_32B_LacZ
  • Species
    Synthetic
  • Promoter T7
  • Tag / Fusion Protein
    • LacZ (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer LacI-R (GGCATACTCTGCGACATCGT)
  • 3′ sequencing primer LacZ-F2 (cctcttcgctattacgccag)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ZIKV_Sensor_32B_LacZ was a gift from James Collins & Alexander Green (Addgene plasmid # 75007 ; http://n2t.net/addgene:75007 ; RRID:Addgene_75007)
  • For your References section:

    Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Pardee K, Green AA, Takahashi MK, Braff D, Lambert G, Lee JW, Ferrante T, Ma D, Donghia N, Fan M, Daringer NM, Bosch I, Dudley DM, O'Connor DH, Gehrke L, Collins JJ. Cell. 2016 May 6. pii: S0092-8674(16)30505-0. doi: 10.1016/j.cell.2016.04.059. 10.1016/j.cell.2016.04.059 PubMed 27160350