ZIKV_Sensor_32B_LacZ
(Plasmid
#75007)
-
PurposeToehold switch sensor to detect Zika Virus
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCOLA Duet
-
Backbone manufacturerEMD Millipore
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameZIKV_sensor_32B_LacZ
-
SpeciesSynthetic
- Promoter T7
-
Tag
/ Fusion Protein
- LacZ (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer LacI-R (GGCATACTCTGCGACATCGT)
- 3′ sequencing primer LacZ-F2 (cctcttcgctattacgccag) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ZIKV_Sensor_32B_LacZ was a gift from James Collins & Alexander Green (Addgene plasmid # 75007 ; http://n2t.net/addgene:75007 ; RRID:Addgene_75007) -
For your References section:
Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Pardee K, Green AA, Takahashi MK, Braff D, Lambert G, Lee JW, Ferrante T, Ma D, Donghia N, Fan M, Daringer NM, Bosch I, Dudley DM, O'Connor DH, Gehrke L, Collins JJ. Cell. 2016 May 6. pii: S0092-8674(16)30505-0. doi: 10.1016/j.cell.2016.04.059. 10.1016/j.cell.2016.04.059 PubMed 27160350