pXPR_BRD003 sgKEAP1-2
(Plasmid
#74986)
-
PurposesgKEAP1-2, puromycin selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXPR_BRD003
-
Backbone manufacturerBroad Institute - Genetic Perturbation Platform
- Backbone size w/o insert (bp) 8318
- Total vector size (bp) 8322
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKEAP1
-
gRNA/shRNA sequenceTGTGTCCTCCACGTCATGAA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GTATGTCTGTTGCTATTATGTCTACTATTCTTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_BRD003 sgKEAP1-2 was a gift from William Hahn (Addgene plasmid # 74986 ; http://n2t.net/addgene:74986 ; RRID:Addgene_74986) -
For your References section:
KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer. Krall EB, Wang B, Munoz DM, Ilic N, Raghavan S, Niederst MJ, Yu K, Ruddy DA, Aguirre AJ, Kim JW, Redig AJ, Gainor JF, Williams JA, Asara JM, Doench JG, Janne PA, Shaw AT, McDonald Iii RE, Engelman JA, Stegmeier F, Schlabach MR, Hahn WC. Elife. 2017 Feb 1;6:e18970. doi: 10.7554/eLife.18970. 10.7554/eLife.18970 PubMed 28145866