pLX_TRC311 ETV4-S
(Plasmid #74983)

• Purpose: Constitutive ETV4 ORF, blasticidin selection
• Depositing Lab: William Hahn
• Publication: Wang et al Cell Rep. 2017 Feb 7;18(6):1543-1557. doi: 10.1016/j.celrep.2017.01.031.

Backbone

• Vector backbone: pLX_TRC311
• Backbone manufacturer: Broad Institute - Genetic Perturbation Platform
• Backbone size w/o insert (bp): 10065
• Total vector size (bp): 9051
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ETV4
• Insert Size (bp): 624
• GenBank ID: NM_001261439.1
• Entrez Gene: ETV4 (a.k.a. E1A-F, E1AF, PEA3, PEAS3)
• Tag / Fusion Protein:
  • V5 (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: CSSB human ORFeome collection (BC007242, clone number 2964546)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry