Skip to main content
Addgene

pLKO.1 shETV1-B
(Plasmid #74974)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74974 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Broad Institute - Genetic Perturbation Platform
  • Backbone size w/o insert (bp) 8901
  • Total vector size (bp) 7082
  • Vector type
    Mammalian Expression, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ETV1
  • gRNA/shRNA sequence
    GAGAGATATGTCTACAAGTTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ETV1 (a.k.a. ER81)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 shETV1-B was a gift from William Hahn (Addgene plasmid # 74974 ; http://n2t.net/addgene:74974 ; RRID:Addgene_74974)
  • For your References section:

    ATXN1L, CIC, and ETS Transcription Factors Modulate Sensitivity to MAPK Pathway Inhibition. Wang B, Krall EB, Aguirre AJ, Kim M, Widlund HR, Doshi MB, Sicinska E, Sulahian R, Goodale A, Cowley GS, Piccioni F, Doench JG, Root DE, Hahn WC. Cell Rep. 2017 Feb 7;18(6):1543-1557. doi: 10.1016/j.celrep.2017.01.031. 10.1016/j.celrep.2017.01.031 PubMed 28178529