pcDNA3-Flag::UbvG08 P69L, L70V, I44A, deltaGG
(Plasmid #74940)

• Purpose: Ubiquitin variant with mutations L69P and V70L reverted to wild type (i53-DM mutant)
• Depositing Lab: Daniel Durocher
• Publication: Canny et al Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27.

Backbone

• Vector backbone: pcDNA3-Flag
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5470
• Total vector size (bp): 5695
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ubiquitin
• Alt name: synthetic engineered ubiquitin variant UbvG08 (i53 DM mutant)
• Alt name: pcDNA3-Flag::i53-DM
• Species: Synthetic
• Insert Size (bp): 225
• Mutation: UbvG08 with I44A, P69L, and L70V mutations and no terminal Glycines
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: gtg gga gtg gca cct tcc ag

Resource Information

• Supplemental Documents:
  • Annotated SnapGene sequence file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

bioRxiv (10.1101/060954)