pcDNA3-Flag::UbvG08 I44A, deltaGG
(Plasmid #74939)

• Purpose: Ubiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53). Blocks 53BP1 from accumulating at sites of DNA damage. Potent selective inhibitor of 53BP1
• Depositing Lab: Daniel Durocher
• Publication: Canny et al Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5470
• Total vector size (bp): 5695
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ubiquitin
• Alt name: synthetic engineered ubiquitin variant UbvG08 (i53)
• Alt name: pcDNA3-Flag::i53
• Species: Synthetic
• Insert Size (bp): 225
• Mutation: UbvG08 with I44A mutation and no terminal Glycines
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: gtg gga gtg gca cct tcc ag

Resource Information

• Supplemental Documents:
  • Annotated SnapGene sequence file
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

bioRxiv (10.1101/060954)