pGM34DEST
(Plasmid
#74756)
-
PurposeEncodes for the 5X repeat of the QUAS response element, followed by the delta pes-10 minimal promoter
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC13T DNA
- Total vector size (bp) 10758
-
Modifications to backboneunc-119(+) rescue cassette
-
Vector typeWorm Expression
-
Selectable markersunc-119(+) rescue cassette
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGateway cassette
-
Insert Size (bp)1703
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGAATGTCTAGAACTAGGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKang Shen Laboratory, Stanford University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bioRxiv doi.org/10.1101/445833
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGM34DEST was a gift from Jordan Ward & Keith Yamamoto (Addgene plasmid # 74756 ; http://n2t.net/addgene:74756 ; RRID:Addgene_74756) -
For your References section:
A New Tool for Inducible Gene Expression in Caenorhabditis elegans. Monsalve GC, Yamamoto KR, Ward JD. Genetics. 2019 Feb;211(2):419-430. doi: 10.1534/genetics.118.301705. Epub 2018 Nov 30. 10.1534/genetics.118.301705 PubMed 30504365
Map uploaded by the depositor.
