Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

NowGFP /pQE-30
(Plasmid #74749)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74749 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQE-30
  • Backbone manufacturer
    QIAGEN
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 4250
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NowGFP
  • Alt name
    WasCFP2
  • Species
    Synthetic
  • Insert Size (bp)
    750
  • Mutation
    WasCFP with substitutions E6K, L42M, T43S, V68M, I128V, V150A, N164Y, K166T, N170D, I171V, Q177L, T230P, and M233A
  • GenBank ID
    KX377672 KX377672
  • Promoter T5
  • Tag / Fusion Protein
    • HisTag (with a mutation but still working) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
  • 3′ sequencing primer CCGAGCGTTCTGAACAAATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NowGFP /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 74749 ; http://n2t.net/addgene:74749 ; RRID:Addgene_74749)
  • For your References section:

    Green fluorescent protein with anionic tryptophan-based chromophore and long fluorescence lifetime. Sarkisyan KS, Goryashchenko AS, Lidsky PV, Gorbachev DA, Bozhanova NG, Gorokhovatsky AY, Pereverzeva AR, Ryumina AP, Zherdeva VV, Savitsky AP, Solntsev KM, Bommarius AS, Sharonov GV, Lindquist JR, Drobizhev M, Hughes TE, Rebane A, Lukyanov KA, Mishin AS. Biophys J. 2015 Jul 21;109(2):380-9. doi: 10.1016/j.bpj.2015.06.018. 10.1016/j.bpj.2015.06.018 PubMed 26200874