KillerOrange /pQE-30
(Plasmid #74748)

• Purpose: KillerOrange gene for bacterial expression
• Depositing Lab: Konstantin Lukyanov
• Publication: Sarkisyan et al PLoS One. 2015 Dec 17;10(12):e0145287. doi: 10.1371/journal.pone.0145287. eCollection 2015.

Backbone

• Vector backbone: pQE-30
• Backbone manufacturer: QIAGEN
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 4250
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: KillerOrange
• Alt name: KO, Killer Orange
• Species: Synthetic
• Insert Size (bp): 723
• Mutation: KillerRed with substitutions G3C Y66W D113S N145S F177L Y221H E236Q
• GenBank ID: KX377673 KX377673
• Promoter: T5
• Tag / Fusion Protein:
  • HisTag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATTGTGAGCGGATAACAATTTC
• 3′ sequencing primer: CCGAGCGTTCTGAACAAATC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry