pJM102: pHps2 RFP on pCM66T
(Plasmid #74741)

• Purpose: pCM66T with promoter pHps2 driving RFP expression (maxRFP = BBa_E1010)
• Depositing Lab: Mary Lidstrom
• Publication: broad host range pcm66t (unpublished)

Backbone

• Vector backbone: pCM66T
• Backbone size w/o insert (bp): 5316
• Total vector size (bp): 6241
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RFP (BioBrick part number BBa_E1010)
• Alt name: mRFP, maxRFP
• Species: Synthetic
• Insert Size (bp): 925
• Promoter: pHps2 (extracted from Methylovorus glucosetrophus SIP3-4 genome)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgattcattaatgcagctggcac
• 3′ sequencing primer: cctctgacacatgcagctccc

Resource Information

• Supplemental Documents:
  • annotated GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

One of a series of plasmids with promoters of differing strengths in Methylovorous glucosetrophus SIP3-4, a RuMP cycle methylotroph:

Addgene # 74738: empty vector, made from pCM66.
Addgene # 74739: pJM100: no-promoter RFP control. Made from pCM66D (AddGene #74738)
Addgene # 74740: pJM101: pHps1 RFP on pCM66T
Addgene # 74741: pJM102: pHps2 RFP on pCM66T
Addgene # 74744: pJM103: 150bp Hps2 RFP on pCM66T
Addgene # 74745: pJM104: pTrc RFP on pCM66T
Addgene # 74746: pJM105: pTac RFP on pCM66T

Backbone is similar backbone to pAWP78 (AddGene plasmid 61263)