Skip to main content
Addgene

pJM102: pHps2 RFP on pCM66T
(Plasmid #74741)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74741 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCM66T
  • Backbone size w/o insert (bp) 5316
  • Total vector size (bp) 6241
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RFP (BioBrick part number BBa_E1010)
  • Alt name
    mRFP, maxRFP
  • Species
    Synthetic
  • Insert Size (bp)
    925
  • Promoter pHps2 (extracted from Methylovorus glucosetrophus SIP3-4 genome)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgattcattaatgcagctggcac
  • 3′ sequencing primer cctctgacacatgcagctccc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

One of a series of plasmids with promoters of differing strengths in Methylovorous glucosetrophus SIP3-4, a RuMP cycle methylotroph:

Addgene # 74738: empty vector, made from pCM66.
Addgene # 74739: pJM100: no-promoter RFP control. Made from pCM66D (AddGene #74738)
Addgene # 74740: pJM101: pHps1 RFP on pCM66T
Addgene # 74741: pJM102: pHps2 RFP on pCM66T
Addgene # 74744: pJM103: 150bp Hps2 RFP on pCM66T
Addgene # 74745: pJM104: pTrc RFP on pCM66T
Addgene # 74746: pJM105: pTac RFP on pCM66T

Backbone is similar backbone to pAWP78 (AddGene plasmid 61263)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM102: pHps2 RFP on pCM66T was a gift from Mary Lidstrom (Addgene plasmid # 74741 ; http://n2t.net/addgene:74741 ; RRID:Addgene_74741)