-
Purpose(Empty Backbone) Small IncP-based broad host range replicating vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74738 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCM66
- Backbone size (bp) 5708
-
Modifications to backboneremoved noncoding components
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgattcattaatgcagctggcac
- 3′ sequencing primer cctctgacacatgcagctccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Similar backbone to pAWP78 (AddGene plasmid 61263)
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCM66T: trimmed pCM66 backbone was a gift from Mary Lidstrom (Addgene plasmid # 74738 ; http://n2t.net/addgene:74738 ; RRID:Addgene_74738)
Map uploaded by the depositor.
