-
PurposeExpress C-terminal YN fused flock house virus (FHV) B2 protein (2741-2956 nt) for dsRNA labeling
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEarley-201
-
Backbone manufacturerThe Plant Journal (2006) 45, 616–629
- Total vector size (bp) 10757
-
Vector typePlant Expression ; double-stranded RNA labeling
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInfluenza A virus NS1 protein, partial
-
Alt nameNS1
-
SpeciesVirus
-
Insert Size (bp)219
- Promoter CaMV 35S
-
Tags
/ Fusion Proteins
- HA
- YFP N-terminal half domain
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 35S-F: CGCAAGACCCTTCCTCTATATAAGGAA
- 3′ sequencing primer OSC-R: ATCTCATTAAAGCAGGACTCTAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdRBFC-B2-YN was a gift from Aiming Wang (Addgene plasmid # 74721 ; http://n2t.net/addgene:74721 ; RRID:Addgene_74721) -
For your References section:
Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation. Cheng X, Deng P, Cui H, Wang A. Virology. 2015 Nov;485:439-51. doi: 10.1016/j.virol.2015.08.023. Epub 2015 Sep 7. 10.1016/j.virol.2015.08.023 PubMed 26351203