pKHR8
(Plasmid #74625)

• Purpose: a plasmid derived from pKHR5: in addition to Venus reporter gene, it also contains cmlc2::mCherry (red heart) reporter gene at 3’ end of the mcs as pKHR7. Genbank accession number is KU144825.
• Depositing Lab: David Grunwald
• Publication: Hoshijima et al Dev Cell. 2016 Mar 21;36(6):654-67. doi: 10.1016/j.devcel.2016.02.015.

Backbone

• Vector backbone: pKHR4
• Backbone size w/o insert (bp): 3048
• Vector type: Cre/Lox ; Zebrafish Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: FRT-alpha-crystallin::Venus-FRT-loxP reporter cassette
• Species: D. rerio (zebrafish), Synthetic
• Insert Size (bp): 1853
• Promoter: alpha-crystallin

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: GTAAAACGACGGCCAGTGA
• 3′ sequencing primer: TGCTGATTTGGAGAGCTCATTT

Gene/Insert 2

• Gene/Insert name: cmlc2::mCherry
• Species: D. rerio (zebrafish)
• Insert Size (bp): 1836
• Promoter: cmlc2

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: CATCCTGCACTGAATGCACA
• 3′ sequencing primer: GGAAACAGCTATGACCATGAT

Resource Information

• Supplemental Documents:
  • pKHR8
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry