-
Purposea cmlc2::mCherry (red heart) reporter gene was inserted at the 3’end of pKHR4 mcs, that resides within donor fragments produced by I-SceI digestion. Genbank accession number is KU144824.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepKHR4
- Backbone size w/o insert (bp) 3048
- Total vector size (bp) 1836
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecmlc2::mCherry
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1836
- Promoter cmlc2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer GTAAAACGACGGCCAGTGA
- 3′ sequencing primer GGAAACAGCTATGACCATGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKHR7 was a gift from David Grunwald (Addgene plasmid # 74624 ; http://n2t.net/addgene:74624 ; RRID:Addgene_74624) -
For your References section:
Precise Editing of the Zebrafish Genome Made Simple and Efficient. Hoshijima K, Jurynec MJ, Grunwald DJ. Dev Cell. 2016 Mar 21;36(6):654-67. doi: 10.1016/j.devcel.2016.02.015. 10.1016/j.devcel.2016.02.015 PubMed 27003937
