-
Purpose(Empty Backbone) an ampR plasmid built from pBluescript: the multiple cloning site (mcs) flanked by inverted head-to-head oriented I-SceI sites. Genbank accession number is KU144822.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBluscript SK+
- Backbone size (bp) 2878
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTAAAACGACGGCCAGTGA
- 3′ sequencing primer GGAAACAGCTATGACCATGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For sequencing multiple cloning sites (mcs) in the empty vector, linearize the plasmid by cutting at a restriction enzyme site, i.e., EcoRI or BamHI, because strong palindromic sequences flank the mcs make sequencing difficult.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKHR4 was a gift from David Grunwald (Addgene plasmid # 74592 ; http://n2t.net/addgene:74592 ; RRID:Addgene_74592) -
For your References section:
Precise Editing of the Zebrafish Genome Made Simple and Efficient. Hoshijima K, Jurynec MJ, Grunwald DJ. Dev Cell. 2016 Mar 21;36(6):654-67. doi: 10.1016/j.devcel.2016.02.015. 10.1016/j.devcel.2016.02.015 PubMed 27003937
