GFP-nArgBP2
(Plasmid #74514)

• Purpose: Express GFP-nArgBP2 fusion protein in mammalian cells
• Depositing Lab: Guoping Feng
• Publication: Zhang et al J Neurosci. 2016 Feb 17;36(7):2247-60. doi: 10.1523/JNEUROSCI.2528-15.2016.

Backbone

• Vector backbone: pEGFP-C2
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nArgBP2
• Alt name: Sorbs2
• Species: M. musculus (mouse)
• Insert Size (bp): 3774
• GenBank ID: KR610443.1
• Entrez Gene: Sorbs2 (a.k.a. 2010203O03Rik, 9430041O17Rik, A530071H08, Argbp2, mKIAA0777, nArgBP2)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry