pBLO1808_arC9_2xNLS_human
(Plasmid
#74491)
-
PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74491 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx330
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namearC9
-
Alt nameallosterically regulated Cas9
-
SpeciesH. sapiens (human)
-
Tag
/ Fusion Protein
- t2a mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site basI (destroyed during cloning)
- 3′ cloning site bsaI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCCT
- 3′ sequencing primer TTCCTCATTTTATTAGGAAAGGACAGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymodified px330 with inserts
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBLO1808_arC9_2xNLS_human was a gift from David Savage (Addgene plasmid # 74491 ; http://n2t.net/addgene:74491 ; RRID:Addgene_74491) -
For your References section:
Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Oakes BL, Nadler DC, Flamholz A, Fellmann C, Staahl BT, Doudna JA, Savage DF. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. 10.1038/nbt.3528 PubMed 27136077