Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJA317
(Plasmid #74488)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74488 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJA291
  • Total vector size (bp) 9287
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    d1ODC
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    124

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer gctcgccgaccactaccagc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJA317 was a gift from Andrew Fire (Addgene plasmid # 74488 ; http://n2t.net/addgene:74488 ; RRID:Addgene_74488)
  • For your References section:

    Translation readthrough mitigation. Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Nature. 2016 Jun 1;534(7609):719-723. doi: 10.1038/nature18308. 10.1038/nature18308 PubMed 27281202
Commonly requested with: