pRFP.mIKKε
(Plasmid
#74414)
-
PurposeExpresses mouse RFP-IKKε in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRFP.C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse IKKε
-
SpeciesM. musculus (mouse)
-
Entrez GeneIkbke (a.k.a. IKK-E, IKK-i, IKKepsilon, Ikki)
- Promoter CMV
-
Tag
/ Fusion Protein
- RFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaacgcgccgagggccgccactc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRFP.mIKKε was a gift from Georgios Stathopoulos (Addgene plasmid # 74414 ; http://n2t.net/addgene:74414 ; RRID:Addgene_74414)