5UAS zfSynaptophysin:GFP-5UAS DsRedExpress
(Plasmid
#74317)
-
PurposeA fusion of zebrafish synaptophysin to GFP and DsRedExpress under the control of separate UAS cassettes; for dual-labeling of retinal ganglion cell (RGC) axon arbors in zebrafish
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N2
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesynaptophysin
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)960
- Promoter 5UAS
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ATGGATGTTGCCAACCAGTT
- 3′ sequencing primer TGGACGAGCTGTACAAGTAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDsRedExpress
-
Insert Size (bp)700
- Promoter 5UAS
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ATGGCCTCCTCCGAGGACGT
- 3′ sequencing primer CACCACCTGTTCCTGTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
5UAS zfSynaptophysin:GFP-5UAS DsRedExpress was a gift from Martin Meyer & Stephen Smith (Addgene plasmid # 74317 ; http://n2t.net/addgene:74317 ; RRID:Addgene_74317) -
For your References section:
Evidence from in vivo imaging that synaptogenesis guides the growth and branching of axonal arbors by two distinct mechanisms. Meyer MP, Smith SJ. J Neurosci. 2006 Mar 29;26(13):3604-14. 10.1523/JNEUROSCI.0223-06.2006 PubMed 16571769