5UAS zfSynaptophysin:GFP
(Plasmid #74316)

• Purpose: A fusion of zebrafish synaptophysin to GFP under the control of 5UAS repeats
• Depositing Labs: Martin Meyer, Stephen Smith
• Publication: Meyer et al J Neurosci. 2006 Mar 29;26(13):3604-14.

Backbone

• Vector backbone: pEGFP-N2
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 6000

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: synaptophysin
• Species: D. rerio (zebrafish)
• Insert Size (bp): 960
• Mutation: Q12H and deletion of F13 (please see depositor comment below)
• Promoter: 5UAS
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Ecor1 (not destroyed)
• 3′ cloning site: Sma1 (not destroyed)
• 5′ sequencing primer: ATGGATGTTGCCAACCAGTT
• 3′ sequencing primer: TGGACGAGCTGTACAAGTAA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositor noted that the Q12H mutation and deletion of F13 found in Addgene's quality control sequence does NOT affect plasmid function.