14UAS zfPSD95:GFP
(Plasmid
#74314)
-
PurposeA fusion of zebrafish PSD95 to GFP under control of 14 UAS repeats
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74314 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N2
-
Backbone manufacturerClontech/Invitrogen
- Backbone size w/o insert (bp) 5
- Total vector size (bp) 7
-
Modifications to backboneCMV promoter removed and replaced with 14 UAS repeats
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namezebrafish PSD95
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)2406
-
MutationY599H and I793S (please see depositor comment below)
- Promoter UAS
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Sma1 (not destroyed)
- 5′ sequencing primer ATGCCTCTCAAACGAGAAGA
- 3′ sequencing primer GGATCCCAGCACGAGAGAGACTGTAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositor noted that the Y599H and I793S mutations found in Addgene's quality control sequence does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
14UAS zfPSD95:GFP was a gift from Martin Meyer & Stephen Smith (Addgene plasmid # 74314 ; http://n2t.net/addgene:74314 ; RRID:Addgene_74314) -
For your References section:
In vivo imaging of synapse formation on a growing dendritic arbor. Niell CM, Meyer MP, Smith SJ. Nat Neurosci. 2004 Mar;7(3):254-60. Epub 2004 Feb 1. 10.1038/nn1191 PubMed 14758365