Skip to main content
Addgene

pAAV-CAG-FLEX-oG-WPRE-SV40pA
(Plasmid #74292)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 74292 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-CAG-FLEX
  • Backbone manufacturer
    E. Boyden lab (MIT)
  • Backbone size w/o insert (bp) 2879
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    oG (optimized Glycoprotein)
  • Species
    glycoprotein for rabies virus SAD B19
  • Mutation
    chimeric glycoprotein
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer WPRE-R
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-FLEX-oG-WPRE-SV40pA was a gift from Edward Callaway (Addgene plasmid # 74292 ; http://n2t.net/addgene:74292 ; RRID:Addgene_74292)

  • For your References section:

    Improved Monosynaptic Neural Circuit Tracing Using Engineered Rabies Virus Glycoproteins. Kim EJ, Jacobs MW, Ito-Cole T, Callaway EM. Cell Rep. 2016 Apr 26;15(4):692-699. doi: 10.1016/j.celrep.2016.03.067. Epub 2016 Apr 14. 10.1016/j.celrep.2016.03.067 PubMed 27149846
Related items:
Commonly requested with: