pCMV6-XL4 ASXL1 (1-479) 3x FLAG
(Plasmid #74262)

• Purpose: Cancer-associated ASXL1 truncation mutant in mammalian expression vector
• Depositing Lab: Anjana Rao
• Publication: Balasubramani et al Nat Commun. 2015 Jun 22;6:7307. doi: 10.1038/ncomms8307.

Backbone

• Vector backbone: pCMV6XL4
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 6500
• Total vector size (bp): 8000
• Modifications to backbone: none
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ASXL1
• Alt name: additional sex combs like 1, transcriptional regulator
• Species: H. sapiens (human)
• Insert Size (bp): 1500
• Mutation: Contains ASXL1 amino acids 1-479
• Entrez Gene: ASXL1 (a.k.a. BOPS, MDS)
• Promoter: 5’LTR
• Tag / Fusion Protein:
  • 3X FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: GGACTTTCCAAAATGTCG
• 3′ sequencing primer: ATTAGGACAAGGCTGGTGGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry