pMXspuro-mCherry-NBR1
(Plasmid #74242)

• Purpose: Retroviral expression of mCherry-NBR1
• Depositing Lab: Jayanta Debnath
• Publication: Kenific et al J Cell Biol. 2016 Feb 29;212(5):577-590. Epub 2016 Feb 22.

Backbone

• Vector backbone: pMXs-puro
• Backbone size w/o insert (bp): 6900
• Total vector size (bp): 10500
• Modifications to backbone: Insert was digested with BglII/XhoI to ligate into the vector which was digested with BamHI/XhoI.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: neighbor of BRCA1 gene 1
• Alt name: NBR1
• Species: H. sapiens (human)
• Insert Size (bp): 2901
• Entrez Gene: NBR1 (a.k.a. 1A1-3B, IAI3B, M17S2, MIG19)
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GACGGCATCGCAGCTTGGATACAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mCherry-NBR1 was amplified and subsequently cloned from pDest-mCherry-NBR1 which was a gift from P. Kim (University of Toronto, Toronto, Ontario, Canada) and T. Johansen (University of Tromsø, Tromsø, Kirkin et al., 2009; Deosaran et al., 2013).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry