pMXspuro-GFP
(Plasmid #74203)

• Purpose: Retroviral control vector containing GFP insert
• Depositing Lab: Jayanta Debnath
• Publication: Kenific et al J Cell Biol. 2016 Feb 29;212(5):577-590. Epub 2016 Feb 22.

Backbone

• Vector backbone: pMXs-puro
• Backbone size w/o insert (bp): 6900
• Total vector size (bp): 7600
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP
• Insert Size (bp): 717

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: GACGGCATCGCAGCTTGGATACAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GFP was cloned from pMXs-IP-GFP-NBR1, a gift from Noboru Mizushima (Addgene plasmid # 38283)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry