p323-L10A-PATagRFP
(Plasmid #74172)

• Purpose: Fluorescent reporter for single ribosome tracking
• Depositing Lab: Robert Singer
• Publication: Katz et al Elife. 2016 Jan 13;5. pii: e10415. doi: 10.7554/eLife.10415.

Backbone

• Vector backbone: p323
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 9263
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ribosomal protein L10A
• Alt name: rpL10A
• Alt name: L10A
• Species: R. norvegicus (rat)
• Insert Size (bp): 651
• Entrez Gene: Rpl10a
• Promoter: UbC
• Tag / Fusion Protein:
  • PATagRFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TGTACCTATCTTCTTAAGTA
• 3′ sequencing primer: CAT AAA GAG ACA GCA ACC AG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry