pVEX-CC1
(Plasmid
#74170)
-
Purposeprotein expression of chicken DCTN1 p150Glued AA 217-548 (CC1) in bacteria
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74170 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepVEX
-
Backbone manufacturerNature Technology Corporation
- Backbone size w/o insert (bp) 4241
- Total vector size (bp) 5240
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDCTN1
-
Alt nameDynactin p150Glued
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)999
-
Entrez GeneDCTN1 (a.k.a. Chip150)
- Promoter Inducible Tac promoter
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CGTGCCATGGAGGAAGAAAATCTGCGTTCC
- 3′ sequencing primer CCGGGATCCTTACTGCTGCTGCTTCTCTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVEX-CC1 was a gift from Trina Schroer (Addgene plasmid # 74170 ; http://n2t.net/addgene:74170 ; RRID:Addgene_74170) -
For your References section:
Dynactin is required for microtubule anchoring at centrosomes. Quintyne NJ, Gill SR, Eckley DM, Crego CL, Compton DA, Schroer TA. J Cell Biol. 1999 Oct 18;147(2):321-34. 10.1083/jcb.147.2.321 PubMed 10525538